cnidocytes pronunciation

For the second non-overlapping MO, the observed morphology and percentage of affected animals counted by the same indices were highly similar, providing strong support for the specificity of the assay (Fig. The cnidarians, or the jellyfish and their kin, are the simplest animal group that displays true tissues, although they possess only two tissue layers. Nuchter T, Benoit M, Engel U, Ozbek S, Holstein TW. Moran Y, Zakon HH. Once the threaded tube of the nematocyst is discharged, it cannot be withdrawn, and thus, these nematocysts are replaced by another one. This was followed by the dissociation of tissues into single cells by flicking the tubes gently and centrifugation at 400g for 15min at 4C. Zenkert C, Takahashi T, Diesner MO, Ozbek S. Morphological and molecular analysis of the Nematostella vectensis cnidom. Further, the capsule elongates at its end into a tubule that is made up of a polymer of peptides, including minicollagens, nematogalectins, and other structural proteins [5, 6]. This work was supported by Israel Science Foundation grant no. Can you pronounce this word better or pronounce in different accent or variation ? Hess J, Angel P, Schorpp-Kistner M. AP-1 subunits: quarrel and harmony among siblings. Interestingly, nine of these ten genes were not previously described in the cnidocytes of Nematostella. 1jl), respectively. Anders S, Pyl PT, Huber W. HTSeqa Python framework to work with high-throughput sequencing data. Pronounce cnidocyte with Precision | English Pronunciation - Howjsay Gur Barzilai M, Reitzel AM, Kraus JE, Gordon D, Technau U, Gurevitz M, Moran Y. Convergent evolution of sodium ion selectivity in metazoan neuronal signaling. 5). e, A nematocyst positive for both antibodies. Background Cnidocytes, the eponymous cell type of the Cnidaria, facilitate both sensory and secretory functions and are among the most complex animal cell types known. In ISH and FISH, embryos older than 4days were treated with 2u/l T1 RNAse (Thermo Fisher Scientific) after probe washing, in order to reduce the background staining. They possess an "explosive" organelle called cnidocyst that is important for prey capture and anti-predator defense. see NEMATOCYST. J Mol Biol. Stefanik DJ, Lubinski TJ, Granger BR, Byrd AL, Reitzel AM, DeFilippo L, Lorenc A, Finnerty JR. Production of a reference transcriptome and transcriptomic database (EdwardsiellaBase) for the lined sea anemone, Edwardsiella lineata, a parasitic cnidarian. Anyone you share the following link with will be able to read this content: Sorry, a shareable link is not currently available for this article. 2011;138(8):144758. Nearly all (about 99 percent) cnidarians are marine species. Each is produced by a special cell called a cnidoblast and contains a coiled, hollow, usually barbed thread, which quickly turns outward (i.e., is everted) from the capsule upon proper stimulation. Some cnidarians are single organisms, others are colonies of many small organisms. The cells that only expressed mRNA lacked capsules or contained undeveloped capsules and multiple vesicles and are probably cnidoblasts or early-stage cnidocytes (Fig. An extraordinary morphological and functional complexity of the cnidocysts has inspired numerous studies to investigate their structure and development. These two genes were found to be significantly upregulated within cnidocytes, ranging between 4 and 5 log2 fold upregulation, when compared to the negative cells. Google Scholar. All content on this website, including dictionary, thesaurus, literature, geography, and other reference data is for informational purposes only. Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. These cells are present around the mouth and tentacles, and . American Pronunciation Guide 1.8K views 1 year ago Learn how to say the letters and sounds in Spanish Butterfly Spanish 2018;7:e35014. This can be explained by the fact that many subtypes of ion channels are known to be specifically expressed in certain other cell types, such as neurons and muscles, but not in cnidocytes [27, 43,44,45]. By retrieving homologs from the genomes and transcriptomes of a diversity of cnidarian species, we reconstructed the phylogenetic histories of two transcription factors that were found to be specifically upregulated in cnidocytes (NVE16876 and NVE5133; Fig. For generating a transgenic line expressing memOrange2 under the native regulatory region of NvNcol-3, we microinjected a Nematostella zygote with a mixture that included guide RNA (250ng/l) of the sequence CAGUAGUUAGGGCAUCCCGG (as part of a transcript also carrying a tracrRNA), Cas9 recombinant protein with nuclear localization signal (500ng/l; PNA Bio, USA), and a donor plasmid that includes two homology arms (spanning positions 1,380,459-1,381,924 and 1,381,925-1,383,035 in scaffold 23 of the N. vectensis genome) spanning the memOrange2 gene. Interestingly, Cnido-Fos1 was the only protein that had different residues than those implicated in the heterodimer formation (Fig. Engel U, Ozbek S, Streitwolf-Engel R, Petri B, Lottspeich F, Holstein TW. (TIF 2050 kb), Figure S5. Rentzsch F, Fritzenwanker JH, Scholz CB, Technau U. FGF signalling controls formation of the apical sensory organ in the cnidarian Nematostella vectensis. Homologs of c-Jun and c-Fos transcription factors were retrieved using the tblastn search [61] against NCBIs non-redundant nucleotide sequence database, N. vectensis genome [49], the EdwardsiellaBase [62], and various cnidarian transcriptomes [63]. 7). These transcription factors are known to dimerize into an activation protein-1 (AP-1) complex, which is involved in various stress responses in Bilateria and Cnidaria [28,29,30]. Cell Rep. 2012;2(2):2428. The localization of expression in ISH experiments strongly suggested that all ten genes exhibited cnidocyte-specific expression (Fig. The three protein disulfide isomerases also showed noticeably distinct expression patterns, strongly indicating functional specialization of these enzymes (Fig. 1 ). b Upregulated GO terms for biological processes, cellular components, and molecular functions in the positive cell population. Among the large number of upregulated genes detected within the positive cell population (Fig. In Nematostella, a single c-Jun (NVE21090) and a single c-Fos (NVE23145) have been identified as players in stress response [28, 40], whereas expression levels of Cnido-Jun and Cnido-Fos (referred to as Jun2 and Fos2, respectively, in one of the previous studies) were found to be insensitive to induced stress conditions. 2009;69(4):23554. Surprisingly, despite cnidocytes being specialized neural cells known for expressing several ion channel subtypes [25,26,27], a depletion of genes associated with ion channels, such as cation transport, sodium ion channels, and potassium ion channels was found (Fig. Kitchen SA, Crowder CM, Poole AZ, Weis VM, Meyer E. De novo assembly and characterization of four anthozoan (phylum Cnidaria) transcriptomes. 5), and (iv) the functional annotation of upregulated transcripts (Additionalfile8: Figure S7; Additionalfile9: Figure S8). Where and when was the first cardboard box made for industrial use? Novel role of calcium in exocytosis: mechanism of nematocyst discharge as shown by x-ray microanalysis. Phonetic spelling of cnidocyte nido-cite cnido-cyte Add phonetic spelling Immunostaining of dissociated cells. Elife. All authors read and approved the final manuscript. Phylum Cnidaria includes animals that show radial or biradial symmetry and are diploblastic, that is, they develop from two embryonic layers. Science. Following isolation, the RNA samples were treated with Turbo DNase (Thermo Fisher Scientific), followed by re-extraction with the Tri-Reagent to remove DNase. cyst n-d-sist plural cnidocysts : nematocyst The stinging cells, or cnidocysts, of sea anemones, jellyfish and other cnidarians work like tiny harpoons when triggered by physical contact. What Are Jellyfish (Jellies)? - National Oceanic and Atmospheric 2011;6(7):e22725. 1a). Correspondence to Using the Acropora digitifera genome to understand coral responses to environmental change. 7b4 Marine Invertebrates - biotas Ether-a-go-go family voltage-gated K+ channels evolved in an ancestral metazoan and functionally diversified in a cnidarian-bilaterian ancestor. Cnidocyte discharge is regulated by light and opsin-mediated Phylum Cnidaria includes animals that exhibit radial or biradial symmetry and are diploblastic, meaning that they develop from two embryonic layers, ectoderm and endoderm. We identified nine genes that were significantly upregulated in positive cells (log2 fold change in the range of 2.8 to 5) and were not known to be specifically expressed in cnidocytes. Renfer E, Amon-Hassenzahl A, Steinmetz PR, Technau U. 2014;15:71. 4ah). Synonyms: nematocyst, cnidoblast. 1d, e). 2008;24(9):4318. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. As a result, the expression of such genes diminishes with the maturation of cnidocytes. Cnidocytes are sometimes known as the cnidoblasts or stinging cells of Cnidarians (animals belonging to the phylum Cnidaria) such as hydrae, corals, jellyfishes, and many more. Thus, different structures within cnidocytes have their significant roles, altogether contributing to defense and offense mechanisms as per the necessity of a condition. 3c, d; Additionalfile3: Figure S3a), many were known cnidocyte marker genes, including toxin (NEP-3, NEP-3-like, NEP-4, and NEP-5) and structural protein-coding genes (NvNcol-1 and NvNcol-4). We then proteolytically dissociated tissues and separated the resulting fluorescent cnidocytes from the other types of cells using a fluorescence-activated cell sorter (FACS). PLoS One. Abstract. The recruitment of the metazoan stress-related transcription factor c-Fos/c-Jun complex into nematogenesis highlights the evolutionary ingenuity and novelty associated with the formation of these highly complex, enigmatic, and phyletically unique organelles. The phylum Cnidaria includes animals that show radial or biradial symmetry and are diploblastic. ( biology) A jellyfish tentacle. Article KS and YM designed the experiments. The primary antibody staining was employed for 2h at room temperature by a rabbit polyclonal antibody against mCherry (Abcam) diluted 1:400. 3e; Additionalfile8: Figure S7; Additionalfile9: Figure S8). The cell suspension was washed twice with PBS and mounted by adding 8l Vectashield antifade medium (Vector Laboratories) on positively charged slides. It is less clear how cnidocytes develop outside the Hydrozoa, as other cnidarians appear to . A cnidocil is present on the cell surface of the cnidocyte and acts as a mechanoreceptor. 2013;15(3):32939. To verify the specificity of the effect, we repeated these experiments with a second non-overlapping MO against Cnido-Jun. Differentially expressed genes within cnidocytes. Biochemical pathways in super-positive cnidocytes. 2002;115(Pt 20):392334. a The depiction of the reporter construct used for the generation of the transgenic reporter line. Noun Filter noun (biology) A capsule, in certain cnidarians, containing a barbed, threadlike tube that delivers a paralyzing sting. However, only in sea anemones, the c-Fos gene underwent an additional round of duplication and led to the origination of Cnido-Fos2 (NVE23145) but was not identified as differentially expressed in a significant manner. Accessed 23 Sept 2018. (TIF 6584 kb), Figure S3. Basic local alignment search tool. Proc Natl Acad Sci U S A. 4). Variability between the transcriptional and proteomic expression levels of cnidocyte-expressed genes. We speculate that this is the reason why some genes previously reported to be involved in early nematogenesis such as PaxA and Mef2 were not recovered in our analysis [23, 35]. Examples for cells containing only RNA, only protein or both RNA and protein are indicated by magenta, gray and orange arrowheads, respectively (panels c and f). How To Pronounce Cnidocyte: Cnidocyte pronunciation Development. 2016;164(12):2944. In a complete contrast, we found insertions in bilaterian c-Fos proteins that were missing in their cnidarian counterparts. Enriched and depleted annotation features of each of these cell populations are also indicated. cnidoblasts or cnidocytes (which contain the stinging capsules or nematocytes) present on the tentacles and the body. 2008;376(4):100820. Grunder S, Assmann M. Peptide-gated ion channels and the simple nervous system of Hydra. We are also thankful to Dr. Robert Zimmermann (University of Vienna) for his advice and support in bioinformatic analyses. Learn About Cnidocytes | Chegg.com Can J Zool. Coelenterates are characterised by the presence of stinging capsules called nematocytes. BMC Biol 16, 108 (2018). 4g). Marlow HQ, Srivastava M, Matus DQ, Rokhsar D, Martindale MQ. Cold Spring Harb Protoc. Putnam NH, Srivastava M, Hellsten U, Dirks B, Chapman J, Salamov A, Terry A, Shapiro H, Lindquist E, Kapitonov VV, et al. This coiled thread is generally barbed and helps with the release of toxins in response to a stimulus. If You Appreciate What We Do Here On PronounceHippo, You Should Consider: PronounceHippo is the fastest growing and most trusted language learning site on the web. Cell type-specific expression profiling unravels the development and To verify that memOrange2-positive cells are indeed young cnidocytes and that their fluorescence follows the expression pattern of NvNcol-3, we fixed and co-immunostained dissociated cells. Similarly, we identified 593 and 348 genes as uniquely upregulated and downregulated, respectively, in the mature cnidocytes of the super-positive population but not in the earlier stages of maturation (Fig. Antonyms not found, are you like to contribute Antonyms of this word please share it. 2010;59(3):30721. Marine Invertebrates - Nature Journals 3e; Additionalfile8: Figure S7; Additionalfile9: Figure S8). Phylum Cnidaria Organisms in Phylum Cnidaria (pronounce: nigh-dare-e-ah) include the corals, hydras, jellyfish, and anemones. c In contrast, planulae injected as zygotes with Cnido-Jun MO exhibit abnormal expression of NvNcol-3, missing the dense expression domain in the aboral pole and most positive cells lack the typical elongated morphology of NvNcol-3-expressing cells. Can you pronounce this word better or pronounce in different accent or variation ? The expression of the transgene in injected zygotes and embryos was monitored under a Nikon SMZ18 fluorescent stereomicroscope equipped with a Nikon Ds-Qi2 monochrome camera and Elements BR software (Nikon, Japan). Gastrulation in the cnidarian Nematostella vectensis occurs via invagination not ingression. The microinjected embryos started expressing the fluorescent protein in their cnidocytes 72h post fertilization (hpf) (Fig. Your US state privacy rights, The numbers of embryos exhibiting a normal NvNcol-3 phenotype out of each injected group based on the two indexes described in the text appear below each merged picture. Ensure that a microphone is installed and that microphone settings are configured correctly. In our reporter line, memOrange2 was integrated into the genomic locus of NvNcol-3the gene coding a vital structural protein of the capsule (Fig. Here, we show that the majority of upregulated genes and enriched biochemical pathways specific to cnidocytes are uncharacterized, emphasizing the need for further functional research on nematogenesis. Proc Natl Acad Sci U S A. Tentacles of Nematostella polyps were dissociated using a combination of papain (2mg/ml; Sigma-Aldrich: P4762), collagenase (2mg/ml; Sigma-Aldrich: C9407), and pronase (4mg/ml; Sigma-Aldrich: P5147) in DTT (1.3M) and PBS (10mM sodium phosphate, 175mM NaCl, pH7.4). Double in situ hybridization expression patterns of three novel cnidocyte-specific genes identified in this study are shown in late planulae. In hydrozoan cnidarians such as Hydra, cnidocytes develop from interstitial stem cells set aside in the ectoderm. Curr Biol. Mar Biotechnol (NY). To validate the cnidocyte-specific expression of these novel genes, we further conducted a double ISH experiment using NvNcol-3 as a cnidocyte marker. 2002;80(10):177294. Cell type-specific expression profiling unravels the development and evolution of stinging cells in sea anemone. In both the wild-type and NvNcol-3 transgenic planulae, a significant proportion of cnidocytes exclusively stained either at the mRNA level or at the protein level (Fig. 691/14, awarded to Y.M., and by the Marie Skodowska-Curie Fellowship awarded to KS. The pellet was gently reconstituted in PBS and placed on a coverslip covered with 2l of Cell-Tak (Corning, USA) inside a 12-well plate at room temperature. Form, function, and occurrence Colloblasts were first described in 1844. Springer Nature. Terms & Conditions | Contact | Privacy Statement. Two distinct populations of cells were sorted and collected: (a) Hoechst-positive and memOrange2-negative cell populations and (b) Hoechst-positive and memOrange2-positive cell populations. The MO bases appear in purple, and the sequence of its binding site in the mRNA appears in green. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Within the cell, a large organelle (called nematocyst, cnidocyst, or cnida) is usually found encapsulating a coiled thread. Wright AV, Nunez JK, Doudna JA. The regulation of cnidocyte discharge - PubMed J Mol Biol. Tentacle. Results of our phylogenetic analyses revealed that Cnido-Jun and Cnido-Fos1 genes originated via duplication events in the common ancestor of hexacorallians (sea anemones and corals), approximately 500 mya [41] (Fig. Choanoflagellate - Wikipedia Available online at: http://www.bioinformatics.babraham.ac.uk/projects/fastqc. Cell. Characterization of taxonomically restricted genes in a phylum-restricted cell type. PLoS One. Listen to the pronunciation of Cnidocyte and learn how to pronounce Cnidocyte correctly. Kafri P, Hasenson SE, Kanter I, Sheinberger J, Kinor N, Yunger S, Shav-Tal Y. Quantifying beta-catenin subcellular dynamics and cyclin D1 mRNA transcription during Wnt signaling in single living cells. These combined assays enabled us to distinguish between NvNcol-3 mRNA and protein expression in the 3-day-old wild-type planulae (Fig. Bioinformatics. Adamczyk P, Meier S, Gross T, Hobmayer B, Grzesiek S, Bachinger HP, Holstein TW, Ozbek S. Minicollagen-15, a novel minicollagen isolated from Hydra, forms tubule structures in nematocysts. Shaner NC, Lin MZ, McKeown MR, Steinbach PA, Hazelwood KL, Davidson MW, Tsien RY. Cnidocytes are specialized cells that define the phylum Cnidaria. 2014;157(6):126278. We also identified multiple duplication events that led to the recruitment of a bilaterian stress response complex into cnidocytes and how it is significant for nematogenesis. Nat Biotechnol. Moreover, the transcripts encoding memOrange2 and NvNcol-3 were not identified as significantly upregulated in both positive and super-positive cnidocytes. 5), albeit with a spatiotemporal variation. 2003-2023 Chegg Inc. All rights reserved. Babonis LS, Martindale MQ. To change, go to chrome://settings/content Exceptions#media-stream. Cold Spring Harb Protoc. 2010;107(1):1048. Similarly, the expression of the NOWA-like gene was limited to a smaller population of cnidocytes in the oral region of the planula and the tentacles of the primary polyp. The deep origin of novel cnidocyte-specific transcription factors in Cnidaria. Cnidarians have cnidocytes (pronounce: nigh-doh-cites), stinging cells that can stun prey or a potential predator. Sea anemones are a group of predatory marine invertebrates of the order Actiniaria. 7a) and a control MO of the sequence CCTCTTACCTCAGTTACAATTTATA, which is predicted to not bind to any Nematostella transcript. Only a small minority of cells expressed either NvNcol-3 or memOrange2 without an overlap. Domain organization of these proteins are also depicted, where the Jun-like domain, the bZIP domains, and the c-Fos-related domains are indicated in blue, green, and purple, respectively. 2012;287(13):9672-81. 7), the results strongly suggest that NvNcol-3, a gene encoding one of the better characterized nematocyst capsule components, is either a direct or indirect target of Cnido-Jun and its partner protein(s). red fluorescent protein. Cnidocyte Definition & Meaning | YourDictionary b Upregulated GO terms for biological processes, cellular components, and molecular functions in the super-positive cell population. b A heatmap of expression in the positive cell population, relative to negative cells, across technical replicates. 4). With this approach, we detected three different populations of cnidocytes: (i) cnidocytes in the very early stages of maturation that only contained abundant transcripts but no proteins, suggesting that they were yet to develop a capsule; (ii) cnidocytes with high levels of both transcripts and proteins, suggesting that these were developing cells but contained an immature capsule; and (iii) mature cnidocytes with fully developed capsules that only contained proteins and completely lacked transcripts for memOrange2 and NvNcol-3 genes (Fig. Layden MJ, Rentzsch F, Rottinger E. The rise of the starlet sea anemone Nematostella vectensis as a model system to investigate development and regeneration. In the immunostaining experiment, 85100% of the cells were positive for both antibodies (a mean overlap of 93%), indicating an overlapping expression. We named these transcription factors Cnido-Jun (4 and 1.5 log2 fold upregulation in positive and super-positive cells, respectively) and Cnido-Fos1 (5 and 4.3 log2 fold upregulation in positive and super-positive cells, respectively) to distinguish them from their paralogs encoding proto-oncogenic transcription factors c-Jun and c-Fos. We initially collected two different cell populations: one that included all cells that were positive for Hoechst stain (indication of an intact nucleus) and memOrange2 (hereinafter referred to as positive cells) and another population that was positive for Hoechst but negative for memOrange2 (negative cells) (Fig. This construct encodes a chimeric protein sequence that carries the first 32 amino acids of NvNcol-3, fused to the memOrange2 sequence, separated by a flexible linker sequence of 2(Gly-Gly-Ser) to allow proper folding of the fluorescent protein. 2010;26(1):13940. TALEN and CRISPR/Cas9-mediated genome editing in the early-branching metazoan Nematostella vectensis. a Enrichment of GO terms in super-positive cnidocytes. Sponges Animals in subkingdom Parazoa represent the simplest animals and include the sponges, or phylum Porifera (Figure 15.2. Dev Biol. plural of cnidocyte . PaxA, but not PaxC, is required for cnidocyte development in the sea anemone Nematostella vectensis. This experimental design further enabled the identification of cnidocyte-specific transcription factors that have originated in Cnidaria from a metazoan stress-related transcription factor complex around 500 million years ago. Figure 1. Our analyses revealed the significant upregulation of genes encoding known cnidocyte markers, such as NvNcol-1, NvNcol-4, NEP-3, NEP-3-like, NEP-4, and NEP-5 [14, 18, 19] in positive cells (Additionalfile4: Figure S4). Mechanisms of cnidocyte development in the moon jellyfish Aurelia Members of phylum "Cnidaria" are commonly referred to as Cnidarians or Coelenterate. Differential expression analyses by two different methods in concert (DESeq2 and edgeR) enabled the stringent identification of a large number of differentially expressed genes in positive and super-positive cell populations, in comparison to the negative cells (Additionalfile3: Figure S3). We counted two different criteria that represent normal cnidogenesis in Nematostella: (i) presence of high NvNCol-3 expression in a ring-shaped domain around the oral pole of the planula. Thus, the identification of numerous novel cnidocyte-specific genes has advanced our knowledge regarding the biology and development of cnidocytes. Terms and Conditions, edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Their distinguishing feature is cnidocytes, specialized cells that they use mainly for capturing prey. 2010;107(43):1853944. How To Pronounce Cnidocytes: Cnidocytes pronunciation pronouncekiwi - How To Pronounce Cnidocytes pronouncekiwi Listen to the pronunciation of Cnidocytes and learn how to pronounce Cnidocytes correctly. Nature. Jungo F, Bougueleret L, Xenarios I, Poux S. The UniProtKB/Swiss-Prot Tox-Prot program: a central hub of integrated venom protein data. 1a). A cnidocyte is usually found in the exodermal layer of Cnidarians. 2007;305(2):48397. Panels a, b, and c present single cells with vesicle-like structures positively stained for mCherry but not in DIC. This is mainly because a cnidocyte usually possesses a large nematocyst or cnidae, the stinging organelle that stores a coiled thread and barb. Elran R, Raam M, Kraus R, Brekhman V, Sher N, Plaschkes I, Chalifa-Caspi V, Lotan T. Early and late response of Nematostella vectensis transcriptome to heavy metals. 3e; Additionalfile8: Figure S7; Additionalfile9: Figure S8) supports a strong evolutionary link between the structural components of the cnidocyst and the constituents of the extracellular matrix [24]. The enrichment of the terms related to the extracellular matrix (Fig. 2012;279(1732):13518. We are grateful to the lab of Yaron Shav-Tal (Bar-Ilan University) for their help with advice on single-cell immunostaining. Positive and negative cells were collected from the tentacles of three independent batches of animals that formed our biological replicates. A cnidocyte is a nucleated cell having an outer layer with a hair-like projection called cnidocil. Moran Y, Fredman D, Praher D, Li XZ, Wee LM, Rentzsch F, Zamore PD, Technau U, Seitz H. Cnidarian microRNAs frequently regulate targets by cleavage. J Cell Sci. 2d; Additionalfile1: Figure S1). Evodevo. KS, YYCS, and YM wrote the paper. Start Free Trial English (UK) Pronunciation English (UK) Pronunciation English (USA) Pronunciation Catalan Pronunciation Chinese (Mandarin) Pronunciation Chinese (China) Pronunciation Chinese (Hong Kong) Pronunciation Chinese (Taiwan) Pronunciation

Duplex For Rent 29223, Artificer Sorcerer Multiclass, Trimedx Site Manager Salary, Copperwynd Liberty Homes Near Dade County School District, Fl, 5 Ways To Keep The Ocean Clean, Articles C